Journal: The Journal of Experimental Medicine

Article Title: Multi-omic comparison of Alzheimer’s variants in human ESC–derived microglia reveals convergence at APOE

doi: 10.1084/jem.20200474

Figure Lengend Snippet: Integrating AD-associated genetic variations into an hMGL model. (A) Schematic depiction of AD-associated risk variants characterized. SNP variants for CD33 and INPP5D , as well as R47H, A528T, and R744X coding variants for TREM2 and SORL1 (SORLA) are marked in red. ITIM, immunoreceptor tyrosine-based inhibitory motif. (B) Workflow pipeline, for generating and characterizing AD-associated mutations in hMGLs. AD-associated coding or noncoding SNPs are introduced into corresponding genomic loci in human H9 ESC lines by CRISPR-Cas9 editing. Each line was characterized for targeted mutations and off-targeting variation before differentiation and maturation into hMGLs. hMGLs were subjected to multi-omic (RNA-seq, ATAC-seq, ChIP-seq, and label-free proteome) analysis, and functional characterization as indicated. (C) Isogenic microglial differentiation scheme used in this study. ESCs were differentiated into HPCs for 10 d, where CD43 + iHPCs are sorted (FACS plots) and cultured in serum-free media with MCSF, IL-34, TGF-β, and insulin; CD43 (green), CX3CR1 (red), Iba1 (purple), and DAPI (blue) staining is shown for HPCs at 10 d in vitro (DIV). Cells were differentiated to microglia for an additional 25 d, whereby maturation was induced by the addition of CD200 and CX3CL1. hMGLs were stained for TREM2 (red), CD43 (green), Iba1 (purple), and DAPI (blue) and compared with HPCs (bottom panels), or TMEM119 in hMGLs (red, bottom right) as indicated. Scale bars represent 100 µm (H9, left panel), 50 µm (mature hMGLs, right panel), and 20 µm (all fluorescence images). (D) Heatmap depicting RNA-seq profiles from human microglia (red; ; GSE99074 , red), hMGLs from this study (purple), iMGLs ( ; GSE117829 , green). (E) 3D PCA of hMGLs (this study, purple), iMGLs ( GSE117829 , turquoise; GSE89189 , dark blue), human fetal microglia ( GSE89189 , green), human adult microglia ( GSE89189 , light blue), myeloid dendritic cells ( GSE89189 , light yellow), monocytes ( GSE89189 , gold). PCA reveals that hMGLs cluster closely with iMGLs and human adult/fetal microglia, and are distinct from myeloid cells.

Article Snippet: 100-nt single-stranded oligodeoxynucleotide (ssODN) repair templates (PAGE purified; Integrated DNA Technology) were designed with homologous genomic sequences flanking the predicted CRISPR-Cas9 cleavage site ( ).

Techniques: CRISPR, RNA Sequencing Assay, ChIP-sequencing, Functional Assay, Cell Culture, Staining, In Vitro, Fluorescence

Journal: The Journal of Experimental Medicine

Article Title: Multi-omic comparison of Alzheimer’s variants in human ESC–derived microglia reveals convergence at APOE

doi: 10.1084/jem.20200474

Figure Lengend Snippet: Gene targeting and experimental strategy for hMGL differentiation and characterization. (A) Schematic representation of the genomic location and intron/exon schematic of AD risk SNPs CD33 , INPP5D , TREM2 , and SORL1 in this study. (B) Schematic diagram of the analytical workflow for this study. RNA-seq datasets from the hMGL lines (1) are analyzed for cross-regulatory interactions to generate an epistatic model (2) and identify potential pathogenic effectors or signatures. hMGL lines are characterized for physiological microglial function (3) and interactions with Aβ in immunodeficient human MCSF knockin mouse brain xenotransplants (4). (C) Representative sequences of various isogenic clones in AD-associated mutant ESC lines and H9-WT sequences. Repair single-strand donor (ssODN) templates, sgRNA (gray), corresponding amino acids, DNA directionality (arrow, 5′ to 3′) and nucleotide substitutions are shown. For TREM2 R47H , two synonymous mutations were introduced in the repair ssODN, generating a new HindIII restriction site (lowercase) for consequent clone screening. (D) Sanger sequencing and validation of CD33 SNP, INPP5D SNP, TREM2 KO, TREM2 R47H , SORL1 KO, and SORL1 A528T lines and isogenic controls (nontargeting sgRNA). The WT H9 ESC line is heterozygous for G/A INPP5D SNPs; CRISPR-Cas9 editing was performed to convert H9 homozygously to the INPP5D “A” allele. All other modifications were converted homozygously in the H9 ESC lines. (E) After maturation induced by exposure to CD200 and CX3CL1, hMGLs were stained for CX3CR1 (red), CD43 (green), Iba1 (purple), and DAPI (blue) as indicated. Scale bar, 20 µm. (F) Representative inward currents from WT hMGLs; hyperpolarizing voltage steps from −160 mV to −60 mV were applied in the absence (top) or presence of Cs + (bottom). At right panel, quantification of inward currents as measured in the absence (black) or presence of Cs + (gray). (G) Induction of cytokines and chemokines in WT hMGLs stimulated with IL-1β (20 ng/ml) and IFN-γ (20 ng/ml) as determined by ELISA multiplex assay. Heatmaps indicate log 2 fold change of cytokines/chemokines indicated (MCP-1, GPOa, HGF, TNFα) above vehicle treatment. Results are from three replicate cultures in three independent experiments. (H) Representative time-lapse images showing WT hMGL migration toward to ATP source (a pipette tip). (I) Representative images of calcium imaging over the time periods as indicated with 100 µM ATP stimulation. Scale bar, 25 µm. Graphs (right) depict Ca 2+ traces depicting changes in Fluo-4 fluorescence over the baseline (ΔF/F0) in response to 100 µM ATP in the WT hMGLs. Results are derived from averaged values in three replicate cultures and three experiments. (J) Representative time-lapse images of fluorescent Aβ 1-42 oligomers (red) bound to WT hMGLs, imaged by automated live-cell microscopy. In the adjacent graph, phagocytosis of Aβ 1-42 oligomers in WT hMGLs over time was quantified, as depicted on the left. PI was determined by measuring average fluorescence intensity at each time point in comparison to the 15-min time point (set to 1.0). Images in E–J are representative of three independent experiments. Values represent mean ± SEM from n = 3 independent experiments.

Article Snippet: 100-nt single-stranded oligodeoxynucleotide (ssODN) repair templates (PAGE purified; Integrated DNA Technology) were designed with homologous genomic sequences flanking the predicted CRISPR-Cas9 cleavage site ( ).

Techniques: RNA Sequencing Assay, Knock-In, Clone Assay, Mutagenesis, Sequencing, CRISPR, Staining, Enzyme-linked Immunosorbent Assay, Multiplex Assay, Migration, Transferring, Imaging, Fluorescence, Derivative Assay, Microscopy

Journal: Journal of biotechnology

Article Title: Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris.

doi: 10.1016/j.jbiotec.2016.03.027

Figure Lengend Snippet: Fig. 1: Critical features for CAS9/gRNA expression affecting the genome editing efficiency. Implementing CRISPR/Cas9 in a given organism is reliant on a set of interdependent components. These features include the DNA sequence of CAS9, the type and position of the NLS for the nuclear import of Cas9, different gRNA sequences and target loci, the promoter for the expression of the gRNAs, the introduction of processing elements for RNA maturation (ribozymes) as well as transcriptional termination. Elements on the plasmid are not drawn to scale. Cas9 (blue) shown on the right side includes the gRNA (red) and the target DNA for cleavage (yellow). The illustration of the Cas9/gRNA complex was taken from the RCSB PDB (see acknowledgements).

Article Snippet: The Homo sapiens codon optimized CAS9 (HsCAS9) and the Streptococcus pyogenes CAS9 (SpCAS9) were amplified from the template vectors p414-TEF1p-Cas9-CYC1t and pMJ806 (both obtained from Addgene, Cambridge, MA, USA) using primer pairs spCas9_fw/spCas9-SV40_rv and hsCas9_fw/ hsCas9-SV40_rv respectively.

Techniques: Expressing, CRISPR, Sequencing, Plasmid Preparation

Journal: Journal of biotechnology

Article Title: Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris.

doi: 10.1016/j.jbiotec.2016.03.027

Figure Lengend Snippet: Fig. 2: High efficiency implementation of CAS9 and gRNA expression in P. pastoris.

Article Snippet: The Homo sapiens codon optimized CAS9 (HsCAS9) and the Streptococcus pyogenes CAS9 (SpCAS9) were amplified from the template vectors p414-TEF1p-Cas9-CYC1t and pMJ806 (both obtained from Addgene, Cambridge, MA, USA) using primer pairs spCas9_fw/spCas9-SV40_rv and hsCas9_fw/ hsCas9-SV40_rv respectively.

Techniques: Expressing

Journal: Journal of biotechnology

Article Title: Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris.

doi: 10.1016/j.jbiotec.2016.03.027

Figure Lengend Snippet: Fig. 4: The CRISPR/Cas9 system allows high efficiency targeting of various genes (A) and is suitable for multiplexing (B, C) in P. pastoris.

Article Snippet: The Homo sapiens codon optimized CAS9 (HsCAS9) and the Streptococcus pyogenes CAS9 (SpCAS9) were amplified from the template vectors p414-TEF1p-Cas9-CYC1t and pMJ806 (both obtained from Addgene, Cambridge, MA, USA) using primer pairs spCas9_fw/spCas9-SV40_rv and hsCas9_fw/ hsCas9-SV40_rv respectively.

Techniques: CRISPR, Multiplexing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: Left panels, During early and late developmental time periods, CRISPR-Cas9 induced indels record cell lineages as mutated genomic barcode sequences. Middle panels, Tissues of interest, such as brain, are dissociated into a single-cell suspension and loaded into a microfluidics device (inDrops). Single cells are encapsulated in droplets and indexed using hydrogels (color-coded to indicate different cell identifier primers) that are coated with oligodT primers. Polyadenylated cellular transcriptomes and scGESTALT lineage barcodes bind to the oligodT sequences and are simultaneously extracted from the same cells. Transcriptome libraries are sequenced to generate gene expression matrices for thousands of single cells. Gene expression profiles are used to perform dimensionality reduction using principal component analysis and visualized in two dimensions on a t-distributed stochastic neighbor embedding (t-SNE) plot. Single cells are represented as grey dots on the shown plot. A modularity-based clustering algorithm (Louvain) is used to cluster cells into discrete cell types using significant principal components. A t-SNE plot of 58,492 cells from n = 22 animals is color-coded to show 63 distinct clusters that were identified from zebrafish juvenile brains72. Right panels, scGESTALT libraries are sequenced to obtain lineage barcodes of profiled single cells. The inDrops index sequences are used to match transcriptomes and lineage barcodes for the same cells. Cell lineage trees are generated using maximum parsimony based on patterns of shared edits. Black and red nodes represent early and late barcode edits, respectively. Dashed lines connect profiled single cells to nodes on the tree. Cells connected to the same node are clonal (i.e. contain the same lineage barcode). Each cell is categorized into a discrete cell type (color coded rectangles) based on prior transcriptional clustering analysis. Brown shades represent forebrain cell types, blue shades represent midbrain cell types, green shades represent hindbrain cell types, and pink shades represent progenitor cell types. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08. Figure adapted from ref72.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: CRISPR, Expressing, Generated

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: An example of a reconstructed lineage tree from a single juvenile zebrafish brain. 376 edited barcodes were recovered from single cells using inDrops. A cell lineage tree was generated from the barcodes based on shared edits using a maximum parsimony approach. Black nodes represent early barcode edits (Cas9 and sgRNA injection at 1-cell stage, Step 35); red nodes represent late edits (heat shock-induced Cas9 transgene expression, Step 38). Dashed lines join single cells to terminal nodes (represent the final edited barcode sequence) on the tree. Distinct cell types (identified from simultaneous transcriptome capture and cell clustering analyses) are color coded as indicated in the legend. The edited barcode for each cell is shown as a white bar with deletions (red) and insertions (blue). Examples of clades and subclades are indicated on the tree. A clade on the tree represents all lineage barcodes that share at least one common edit, and sub-clades that branch from the original clade contain increasingly restricted subsets of barcodes that contain the previous edit(s) as well as additional shared edits. Adapted with permission from ref72. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Generated, Injection, Expressing, Sequencing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: Zebrafish with single-copy heat shock promoter-driven scGESTALT barcode (to promote ubiquitous barcode expression at stage of interest) are crossed to zebrafish that express heat shock-inducible Cas9 and U6-driven sgRNAs 5–9. The barcode is cloned downstream of the dsRed coding sequence and upstream of the SV40 polyadenylation sequence (pA). Resulting embryos are injected with Cas9 protein and sgRNAs 1–4 at the one-cell stage (blue bars; early editing). The embryos are screened for GFP positive heart transgenics (cmlc2 promoter drives heart-specific GFP expression) at 30 hpf to identify embryos containing the barcode transgene, and sorted embryos are heat shocked to induce transgenic Cas9 for a second round of editing (orange bars; late editing). The embryos are screened again for ubiquitous GFP expression (Cas9 is linked to GFP with a t2A self-cleaving peptide), which indicates successful Cas9 transgene induction. Double transgenic embryos are grown for downstream profiling, and heat shocked at time of interest (e.g. juvenile stage 23–25 dpf) to induce expression of the edited barcode array prior to scRNA-seq analysis. Protocol steps for each stage are indicated. Adapted with permission from ref72.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Expressing, Clone Assay, Sequencing, Injection, Transgenic Assay

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: scGESTALT barcode zebrafish were crossed to zebrafish that express heat shock-inducible Cas9 and U6-driven sgRNAs 5–9. Resulting embryos were injected with Cas9 protein and sgRNAs 1–4 at the one-cell stage. Embryos were heat shocked at 30 hpf to induce transgenic Cas9 for a late round of editing. Double transgenic (scGESTALT+, hsp:Cas9+; lanes 2–8, n = 7 embryos) and single transgenic (scGESTALT+, hsp:Cas9−; lanes 9–12, n = 4 embryos) were identified by screening for GFP expression. The gel shows PCR results of amplifying the scGESTALT barcode (unedited = ~300 bp). Large smear patterns (120–250bp) are observed in early and late edited embryos (lanes 2–8), whereas embryos that were only mutated at sites 1–4 display less editing (lanes 9–12. The band at ~200 bp in lane 12 likely represents large deletion(s) between sites 1–4 that occurred early in development and was inherited by most cells. Note that samples with such dominant large deletions should not be used for downstream experiments and analyses as they are likely to have low barcode diversity). Sample in lane 11 was likely not efficiently injected. Lane 1 represents a control embryo, which was injected with Cas9 protein only (no sgRNAs 1–4, n = 1 embryo) and was not heat shocked. As expected, the barcode is not edited in this case. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Injection, Transgenic Assay, Expressing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Sequencing, Transgenic Assay, CRISPR, Injection, Multiplexing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Concentration Assay, Plasmid Preparation

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Concentration Assay

Journal: Frontiers in Plant Science

Article Title: Multiplexed Genome Editing via an RNA Polymerase II Promoter-Driven sgRNA Array in the Diatom Phaeodactylum tricornutum : Insights Into the Role of StLDP

doi: 10.3389/fpls.2021.784780

Figure Lengend Snippet: A schematic diagram for the assembly of Level-0 Universal Loop parts into Level-1 transcriptional units and the final assembly of a Level-2 CRISPR/Cas9 diatom episome in the pCA plasmid kit. (A) a pCA-Level-1_2-sgRNA array was assembled in a Level-1 Golden Gate reaction with the BsaI enzyme and T4 DNA ligase for 30 cycles by combining Level-0 parts and sgRNA fragments with indicated overhangs. (B) A pCA-Level-1_3-SpCas9-P2A- Sh Ble/ Bsr1 transcriptional unit was assembled in a Level-1 Golden Gate reaction with the BsaI enzyme and T4 DNA ligase for 25 cycles by combining Level-0 parts with indicated overhangs. Promoter-terminator combination used for the sgRNA array is not reused for Sp Cas9-P2A- Sh Ble/ Bsr1 in the same Level-2 episome.

Article Snippet: Similarly, for the E. coli -mediated delivery of the multiplexed CRISPR/Cas9 episome, NEB® Stable E. coli was transformed with pTA-Mob ( ) and the Level-2 diatom episome.

Techniques: CRISPR, Plasmid Preparation

Journal: Frontiers in Plant Science

Article Title: Multiplexed Genome Editing via an RNA Polymerase II Promoter-Driven sgRNA Array in the Diatom Phaeodactylum tricornutum : Insights Into the Role of StLDP

doi: 10.3389/fpls.2021.784780

Figure Lengend Snippet: Editing efficiency of two episome constructs with orthogonal RNA polymerase II promoters driving gRNA and Cas9 expression to detect deletions in the StLDP gene.

Article Snippet: Similarly, for the E. coli -mediated delivery of the multiplexed CRISPR/Cas9 episome, NEB® Stable E. coli was transformed with pTA-Mob ( ) and the Level-2 diatom episome.

Techniques: Construct, Expressing

Journal: Cancer Research

Article Title: HuR Small-Molecule Inhibitor Elicits Differential Effects in Adenomatosis Polyposis and Colorectal Carcinogenesis

doi: 10.1158/0008-5472.can-15-1726

Figure Lengend Snippet: Figure 6. Effect of MS-444 on immune cells. A, Serum cytokine expression in AOM/ DSS–treated mice was analyzed using ProcartaPlex Multiplex Immunoassay. MS-444 significantly reduced IL18 serum levels (P ¼ 0.05). A trend for reduced eotaxin (P ¼ 0.195), IL22 (P ¼ 0.13), and IL23 (P ¼ 0.15) serum levels was found upon MS-444 treatment. Data are represented as mean SD (n ¼ 8 mice per group, technical duplicates were performed). B, RAW 264.7 wt and HuRko (CRISPR/ Cas9 HuR knockout) macrophages were treated with 10 ng/mL LPS and/or 50 mmol/L MS-444 for 4 hours. Untreated and DMSO-treated cells were used as controls. IL18 secretion was assessed in supernatants of wt and HuRko RAWs using a Multiplex Immunoassay. C, Relative IL18 mRNA levels were calculated using qRT-PCR and 36b4 as endogenous control (technical duplicates were performed; data are representative of two independent experiments). D and E, Eosinophil and neutrophil infiltration into tumors was counted (60 objective; >60 FoVs were analyzed). Upon MS-444, the number of eosinophils was significantly reduced upon MS-444 in AOM/DSS–treated mice (D, top) but not in APCMin mice (E, top). Neutrophils within tumors were not altered (D and E, bottom). F, Representative images of tumor- invading neutrophils (arrowhead, inset 1) and eosinophils (arrows, inset 2) in sham-treated (top) and MS-444–treated (bottom) AOM/DSS mice. , P 0.05; , P < 0.001.

Article Snippet: For CRISPR/Cas9 HuR knockout in Raw 264.7 macrophages gRNA (guiding sequence: CCACATGGCGGAAGACTGCA) against exon 2 within HuR gene (ENSMUST00000098950) and purified recombinant Cas9 protein with 2 nuclear localization signals were provided by VBCF Protein Technologies facility (http://www.vbcf. ac.at).

Techniques: Expressing, Multiplex Assay, CRISPR, Knock-Out, Quantitative RT-PCR, Control

Journal: AIDS Research and Human Retroviruses

Article Title: Analysis of CRISPR/Cas9 Guide RNA Efficiency and Specificity Against Genetically Diverse HIV-1 Isolates

doi: 10.1089/aid.2020.0055

Figure Lengend Snippet: Figure 5. CRISPR/Cas9 cleavage of 5’LTR in TZM-bl cells with one or more LTR guide

Article Snippet: Cas9 treated DNA was A-tailed, ligated to the NEBNext adaptor for Illumina (NEB catalog #E7601A), USER enzyme-treated, and amplified by PCR using KAPA Hifi polymerase (KAPA Biosystems, KK2601) and NEBNext® Multiplex Oligos for Illumina® (catalog# E7600S).

Techniques: CRISPR